ID: 943944121_943944123

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 943944121 943944123
Species Human (GRCh38) Human (GRCh38)
Location 2:194036614-194036636 2:194036632-194036654
Sequence CCTCTTTAAGCCACGAAGCAAAT CAAATAAATGCATACATCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 3, 3: 80, 4: 566}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!