ID: 944057970_944057975

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 944057970 944057975
Species Human (GRCh38) Human (GRCh38)
Location 2:195543460-195543482 2:195543482-195543504
Sequence CCCTCATGTTTCTTCTTATAAGG GGCACTAATCCCATTCATGAGGG
Strand - +
Off-target summary No data {0: 378, 1: 1063, 2: 1820, 3: 1960, 4: 1822}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!