ID: 944057972_944057974

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 944057972 944057974
Species Human (GRCh38) Human (GRCh38)
Location 2:195543461-195543483 2:195543481-195543503
Sequence CCTCATGTTTCTTCTTATAAGGG GGGCACTAATCCCATTCATGAGG
Strand - +
Off-target summary No data {0: 345, 1: 994, 2: 1836, 3: 2093, 4: 2018}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!