ID: 944091474_944091480

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 944091474 944091480
Species Human (GRCh38) Human (GRCh38)
Location 2:195916732-195916754 2:195916769-195916791
Sequence CCTGTAGTCCTTGCTACTCGGGA AGTCATTTGAAGCCTGGAGACGG
Strand - +
Off-target summary {0: 11, 1: 1925, 2: 65852, 3: 194383, 4: 272965} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!