ID: 944250988_944250993

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 944250988 944250993
Species Human (GRCh38) Human (GRCh38)
Location 2:197580052-197580074 2:197580088-197580110
Sequence CCAGTTCATGGCCCACTTGGCAA CTTTACCGCCCTAGACCCAGAGG
Strand - +
Off-target summary No data {0: 27, 1: 39, 2: 32, 3: 16, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!