ID: 944330403_944330407

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 944330403 944330407
Species Human (GRCh38) Human (GRCh38)
Location 2:198458750-198458772 2:198458787-198458809
Sequence CCACAAGAAAGAAATGAGCTTAG ATTTACATGCAGAATTTAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 283} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!