ID: 944427230_944427232 |
View in Genome Browser |
Spacer: 4 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 944427230 | 944427232 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 2:199595851-199595873 | 2:199595878-199595900 |
Sequence | CCTCATCTGTAAAACAGAGATGA | AATAAAACAACCTTTAGGAGTGG |
Strand | - | + |
Off-target summary | {0: 3, 1: 41, 2: 332, 3: 1370, 4: 4363} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |