ID: 944427230_944427232

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 944427230 944427232
Species Human (GRCh38) Human (GRCh38)
Location 2:199595851-199595873 2:199595878-199595900
Sequence CCTCATCTGTAAAACAGAGATGA AATAAAACAACCTTTAGGAGTGG
Strand - +
Off-target summary {0: 3, 1: 41, 2: 332, 3: 1370, 4: 4363} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!