ID: 944427230_944427234 |
View in Genome Browser |
Spacer: 27 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 944427230 | 944427234 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 2:199595851-199595873 | 2:199595901-199595923 |
| Sequence | CCTCATCTGTAAAACAGAGATGA | CAGCGAAGTGAAGTGAACCAAGG |
| Strand | - | + |
| Off-target summary | {0: 3, 1: 41, 2: 332, 3: 1370, 4: 4363} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||