ID: 944495595_944495602

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 944495595 944495602
Species Human (GRCh38) Human (GRCh38)
Location 2:200305115-200305137 2:200305141-200305163
Sequence CCTACCTGGTTCAGGTAATCCTC CCTCAGCCTCCTGAGTAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 671, 4: 11863} {0: 96881, 1: 202886, 2: 238913, 3: 154169, 4: 85070}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!