ID: 944495595_944495604

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 944495595 944495604
Species Human (GRCh38) Human (GRCh38)
Location 2:200305115-200305137 2:200305149-200305171
Sequence CCTACCTGGTTCAGGTAATCCTC TCCTGAGTAGCTGGGACTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 671, 4: 11863} {0: 40895, 1: 157395, 2: 217955, 3: 208005, 4: 130380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!