ID: 944675833_944675843

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 944675833 944675843
Species Human (GRCh38) Human (GRCh38)
Location 2:202033817-202033839 2:202033864-202033886
Sequence CCCGACGCTTCTTCTGGCGACCA CGCTCACTCCCGGCGGGCGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!