ID: 944868160_944868169

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 944868160 944868169
Species Human (GRCh38) Human (GRCh38)
Location 2:203882454-203882476 2:203882495-203882517
Sequence CCTGTCTCCATGAAAAATACAAA GCATGCGCCAGCAACTCGGGAGG
Strand - +
Off-target summary {0: 14, 1: 674, 2: 13995, 3: 196377, 4: 221873} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!