ID: 945063073_945063075

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 945063073 945063075
Species Human (GRCh38) Human (GRCh38)
Location 2:205925304-205925326 2:205925322-205925344
Sequence CCACTTGGGAGGCTGAGGTGGGA TGGGACGATCGCTGGAGCCCAGG
Strand - +
Off-target summary No data {0: 2, 1: 141, 2: 4316, 3: 28925, 4: 66540}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!