ID: 945206688_945206694

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 945206688 945206694
Species Human (GRCh38) Human (GRCh38)
Location 2:207340449-207340471 2:207340474-207340496
Sequence CCCTAAAATAGAATCCATTCCAG GCCCAATATGGATTCAGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 274} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!