ID: 945516774_945516779

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 945516774 945516779
Species Human (GRCh38) Human (GRCh38)
Location 2:210772334-210772356 2:210772363-210772385
Sequence CCAGAAATACCATTGAATCCAGC ATTACTGAGTATATACCCAAAGG
Strand - +
Off-target summary No data {0: 663, 1: 19624, 2: 11708, 3: 7233, 4: 6010}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!