ID: 945650406_945650412

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 945650406 945650412
Species Human (GRCh38) Human (GRCh38)
Location 2:212551622-212551644 2:212551637-212551659
Sequence CCTTCCTGTTATAACCTCCCATG CTCCCATGATAGAAGGGGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 39, 3: 265, 4: 755}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!