ID: 945749288_945749294

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 945749288 945749294
Species Human (GRCh38) Human (GRCh38)
Location 2:213760811-213760833 2:213760837-213760859
Sequence CCAGAAGCATGGTGCCAACATTT AAGGGACATCCTATGGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 43, 4: 215} {0: 1, 1: 2, 2: 7, 3: 35, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!