ID: 945897028_945897033

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 945897028 945897033
Species Human (GRCh38) Human (GRCh38)
Location 2:215495023-215495045 2:215495054-215495076
Sequence CCAGGATGTGGAACAACAGGAAT TTGCTGGTGGGGATGCAAAACGG
Strand - +
Off-target summary No data {0: 18, 1: 268, 2: 1080, 3: 2335, 4: 3861}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!