ID: 945983241_945983242

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 945983241 945983242
Species Human (GRCh38) Human (GRCh38)
Location 2:216333043-216333065 2:216333070-216333092
Sequence CCATAACTCTTCTAGAAGAAAAC AAGAATGTTTTCATGATCTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 51, 3: 387, 4: 2843} {0: 1, 1: 0, 2: 11, 3: 91, 4: 668}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!