ID: 946003071_946003083

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 946003071 946003083
Species Human (GRCh38) Human (GRCh38)
Location 2:216499084-216499106 2:216499130-216499152
Sequence CCGGGCCTTCGGAGCGCGCGGCC GGTTGAATTTAGGGAAAACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132} {0: 1, 1: 0, 2: 0, 3: 15, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!