ID: 946085924_946085931

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 946085924 946085931
Species Human (GRCh38) Human (GRCh38)
Location 2:217171450-217171472 2:217171473-217171495
Sequence CCACCTGGGCTCCTCCCCACTCC TCCTTCCAACCAGATGTGTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!