ID: 946185493_946185514

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 946185493 946185514
Species Human (GRCh38) Human (GRCh38)
Location 2:217978556-217978578 2:217978599-217978621
Sequence CCCCAGCCCGCCCCTGCCCCCGC CTTGACCTGCGCCCGCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 33, 3: 301, 4: 2160} {0: 1, 1: 0, 2: 0, 3: 23, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!