ID: 946185498_946185516

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 946185498 946185516
Species Human (GRCh38) Human (GRCh38)
Location 2:217978563-217978585 2:217978605-217978627
Sequence CCGCCCCTGCCCCCGCCCCCGGG CTGCGCCCGCTCCCAGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 63, 3: 572, 4: 2915} {0: 1, 1: 0, 2: 7, 3: 54, 4: 539}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!