ID: 946185510_946185516

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 946185510 946185516
Species Human (GRCh38) Human (GRCh38)
Location 2:217978581-217978603 2:217978605-217978627
Sequence CCGGGCCTTCGCCTTCACCTTGA CTGCGCCCGCTCCCAGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 224} {0: 1, 1: 0, 2: 7, 3: 54, 4: 539}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!