ID: 946185512_946185528

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 946185512 946185528
Species Human (GRCh38) Human (GRCh38)
Location 2:217978592-217978614 2:217978645-217978667
Sequence CCTTCACCTTGACCTGCGCCCGC GAGAGGAGGAGGGACGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 150} {0: 1, 1: 0, 2: 2, 3: 43, 4: 412}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!