ID: 946185749_946185752

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 946185749 946185752
Species Human (GRCh38) Human (GRCh38)
Location 2:217979576-217979598 2:217979597-217979619
Sequence CCAGAAGCTGGAATCAAATTTCC CCTATAAGGTTCCCGAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 170} {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!