ID: 946326072_946326080

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 946326072 946326080
Species Human (GRCh38) Human (GRCh38)
Location 2:218985277-218985299 2:218985302-218985324
Sequence CCAGCTAAGGGGCCGCTTGGAAC TCCGGCCCCCGCGCGGCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 48} {0: 1, 1: 0, 2: 1, 3: 32, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!