ID: 946362841_946362853

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 946362841 946362853
Species Human (GRCh38) Human (GRCh38)
Location 2:219229417-219229439 2:219229452-219229474
Sequence CCGCCGGCGGCGCCCCTTCCTCC GAGCTCACTTAGGGCTCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 476} {0: 1, 1: 0, 2: 0, 3: 5, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!