ID: 946362850_946362859

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 946362850 946362859
Species Human (GRCh38) Human (GRCh38)
Location 2:219229444-219229466 2:219229477-219229499
Sequence CCCGCCGCGAGCTCACTTAGGGC CCCCTGGGCAAGGCCAGACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45} {0: 1, 1: 1, 2: 0, 3: 40, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!