ID: 946362851_946362864

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 946362851 946362864
Species Human (GRCh38) Human (GRCh38)
Location 2:219229445-219229467 2:219229484-219229506
Sequence CCGCCGCGAGCTCACTTAGGGCT GCAAGGCCAGACACGGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43} {0: 1, 1: 0, 2: 0, 3: 24, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!