ID: 946362857_946362865

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 946362857 946362865
Species Human (GRCh38) Human (GRCh38)
Location 2:219229468-219229490 2:219229485-219229507
Sequence CCGCAGGCACCCCTGGGCAAGGC CAAGGCCAGACACGGGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 299} {0: 1, 1: 0, 2: 0, 3: 7, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!