ID: 946623949_946623956

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 946623949 946623956
Species Human (GRCh38) Human (GRCh38)
Location 2:221591148-221591170 2:221591200-221591222
Sequence CCAGACTCCCTCCCCATGCTAAT ATGAATTAAGCAGTAATTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 212} {0: 1, 1: 0, 2: 0, 3: 12, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!