ID: 946806078_946806082

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 946806078 946806082
Species Human (GRCh38) Human (GRCh38)
Location 2:223472531-223472553 2:223472555-223472577
Sequence CCTATTCCAATTGGGGTGGTAGA CAATCTTTGTTTTCCAGAAGGGG
Strand - +
Off-target summary No data {0: 4, 1: 5, 2: 12, 3: 37, 4: 416}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!