ID: 946829235_946829239

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 946829235 946829239
Species Human (GRCh38) Human (GRCh38)
Location 2:223711203-223711225 2:223711249-223711271
Sequence CCAGCCTGGGTGTCTGAGGCCCT ATCCTGATCATAACTCTGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 6, 3: 51, 4: 408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!