ID: 946882058_946882068

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 946882058 946882068
Species Human (GRCh38) Human (GRCh38)
Location 2:224186184-224186206 2:224186237-224186259
Sequence CCTGGGGTTCTATCCGAAAGGGC TGCAGGATGGTGAGAGGAAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!