ID: 946889891_946889897

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 946889891 946889897
Species Human (GRCh38) Human (GRCh38)
Location 2:224264423-224264445 2:224264443-224264465
Sequence CCGTTTCAGATCCTTGGAAAGTG GTGTGTTTGGGGAGAGGAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 98, 4: 746}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!