ID: 947154254_947154259

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 947154254 947154259
Species Human (GRCh38) Human (GRCh38)
Location 2:227145524-227145546 2:227145569-227145591
Sequence CCATCATCTTATTTAACGCTTAA GGTCACACCATTCCAAAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 173} {0: 1, 1: 0, 2: 3, 3: 10, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!