ID: 947295606_947295609

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 947295606 947295609
Species Human (GRCh38) Human (GRCh38)
Location 2:228627262-228627284 2:228627286-228627308
Sequence CCATGGGATGACAGGGATTTGAC GGACAGCAGGTGTCACATCGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 6, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!