ID: 947319851_947319855

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 947319851 947319855
Species Human (GRCh38) Human (GRCh38)
Location 2:228904927-228904949 2:228904976-228904998
Sequence CCAGCTATTAACAGTCTTGAGAC CTAGTGGCTTAGAGAGATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 59} {0: 1, 1: 0, 2: 0, 3: 20, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!