ID: 947454511_947454522

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 947454511 947454522
Species Human (GRCh38) Human (GRCh38)
Location 2:230241593-230241615 2:230241645-230241667
Sequence CCAGTCCTCCTCCCCTCACACAG TGTGAGAGAACCAATGAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 583} {0: 1, 1: 0, 2: 2, 3: 28, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!