ID: 947539310_947539327 |
View in Genome Browser |
Spacer: 28 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 947539310 | 947539327 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 2:230964275-230964297 | 2:230964326-230964348 |
Sequence | CCTTGGGCGGTGATGGGACCCAG | CCCACGGAGGTGGGGAGGCTCGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |