ID: 947718172_947718185

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 947718172 947718185
Species Human (GRCh38) Human (GRCh38)
Location 2:232352149-232352171 2:232352193-232352215
Sequence CCCCCTCGCGGGGCGCGGGCTGG GAGCCGCGCCGCTCAGTCCGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!