ID: 947745188_947745201

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 947745188 947745201
Species Human (GRCh38) Human (GRCh38)
Location 2:232503610-232503632 2:232503647-232503669
Sequence CCTCTTTACCCTCGCTTCCCCCC AGGCGGCTAATTCCCGAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 33, 4: 452} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!