ID: 947765924_947765929

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 947765924 947765929
Species Human (GRCh38) Human (GRCh38)
Location 2:232637288-232637310 2:232637315-232637337
Sequence CCCTGAGCACCTGGTGCTCTCCC TGTGTTTCTGTGTCTTCACATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 4, 3: 58, 4: 250} {0: 3, 1: 17, 2: 77, 3: 284, 4: 1394}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!