ID: 947998056_947998058

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 947998056 947998058
Species Human (GRCh38) Human (GRCh38)
Location 2:234545008-234545030 2:234545021-234545043
Sequence CCGTCTCTTTCTCAAGGATCCCC AAGGATCCCCAGTGTGGAAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 304} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!