ID: 948060961_948060965

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 948060961 948060965
Species Human (GRCh38) Human (GRCh38)
Location 2:235043039-235043061 2:235043076-235043098
Sequence CCGTGAGGACCCTGCTCATGGAG GCGCTCCTTCGCTGACGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 61, 4: 592} {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!