ID: 948147300_948147305

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 948147300 948147305
Species Human (GRCh38) Human (GRCh38)
Location 2:235717109-235717131 2:235717123-235717145
Sequence CCTAGACTCATCCCCTAAAGATG CTAAAGATGCTACCATGCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 127} {0: 1, 1: 0, 2: 2, 3: 67, 4: 460}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!