ID: 948193927_948193935

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 948193927 948193935
Species Human (GRCh38) Human (GRCh38)
Location 2:236080968-236080990 2:236081001-236081023
Sequence CCATGTAAGGTCACATAGTCACA ATTAGGACGTTGACATCTTTGGG
Strand - +
Off-target summary {0: 2, 1: 20, 2: 169, 3: 509, 4: 931} {0: 2, 1: 82, 2: 278, 3: 686, 4: 1259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!