|
Left Crispr |
Right Crispr |
Crispr ID |
948247609 |
948247617 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:236499548-236499570
|
2:236499598-236499620
|
Sequence |
CCTCCTGGGTAGCTGGGACTACA |
TTTGTATTTTTAGTAGAGATGGG |
Strand |
- |
+ |
Off-target summary |
{0: 833, 1: 44541, 2: 164491, 3: 223530, 4: 208480} |
{0: 86734, 1: 238723, 2: 156972, 3: 78020, 4: 57628} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|