|
Left Crispr |
Right Crispr |
| Crispr ID |
948247611 |
948247617 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:236499551-236499573
|
2:236499598-236499620
|
| Sequence |
CCTGGGTAGCTGGGACTACAGGC |
TTTGTATTTTTAGTAGAGATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1085, 1: 77204, 2: 197805, 3: 240697, 4: 177015} |
{0: 86734, 1: 238723, 2: 156972, 3: 78020, 4: 57628} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|